Disrupted tRNA Genes and tRNA Fragments: A Perspective on tRNA Gene Evolution
نویسنده
چکیده
Transfer RNAs (tRNAs) are small non-coding RNAs with lengths of approximately 70-100 nt. They are directly involved in protein synthesis by carrying amino acids to the ribosome. In this sense, tRNAs are key molecules that connect the RNA world and the protein world. Thus, study of the evolution of tRNA molecules may reveal the processes that led to the establishment of the central dogma: genetic information flows from DNA to RNA to protein. Thanks to the development of DNA sequencers in this century, we have determined a huge number of nucleotide sequences from complete genomes as well as from transcriptomes in many species. Recent analyses of these large data sets have shown that particular tRNA genes, especially in Archaea, are disrupted in unique ways: some tRNA genes contain multiple introns and some are split genes. Even tRNA molecules themselves are fragmented post-transcriptionally in many species. These fragmented small RNAs are known as tRNA-derived fragments (tRFs). In this review, I summarize the progress of research into the disrupted tRNA genes and the tRFs, and propose a possible model for the molecular evolution of tRNAs based on the concept of the combination of fragmented tRNA halves.
منابع مشابه
Identified Hybrid tRNA Structure Genes in Archaeal Genome
Background: In Archaea, previous studies have revealed the presence of multiple intron-containing tRNAs and split tRNAs. The full unexpurgated analysis of archaeal tRNA genes remains a challenging task in the field of bioinformatics, because of the presence of various types of hidden tRNA genes in archaea. Here, we suggested a computational method that searched for widely separ...
متن کاملهای اسید گلوتامیک، تریپتوفان، آلانین tRNA بررسی مولکولی در Long QT وآسپارژین درژنوم میتوکندری بیماران مبتلا بهسندرم مقایسه با گروه کنترل
Background and purpose: Long QT syndrome is a heart arrhythmia identified by prolongation of the QT interval which is a cause of sudden cardiac death in young individuals. In most cases, abnormalities in heart repolarization are reasons of prolongation of action potential and arrhythmia. The activity of ion channels is sensitive to ATP level, therefore, mitochondrial disorders are considered...
متن کاملIdentification of highly-disrupted tRNA genes in nuclear genome of the red alga, Cyanidioschyzon merolae 10D
The limited locations of tRNA introns are crucial for eukaryal tRNA-splicing endonuclease recognition. However, our analysis of the nuclear genome of an early-diverged red alga, Cyanidioschyzon merolae, demonstrated the first evidence of nuclear-encoded tRNA genes that contain ectopic and/or multiple introns. Some genes exhibited both intronic and permuted structures in which the 3'-half of the...
متن کاملTransfer RNA genes in pieces are an ancestral character.
randau & Söll (2008) suggest that the anticodon loop region of transfer rNa (trNa) genes is the target site of a huge variety of mobile genetic elements and that this resulted in the evolution of trNa genes in pieces. they therefore suggest that the presence of introns in the anticodon loop might not be a plesiomorphic trait that is important in trNa origin (Di giulio, 2006), but an acquired tr...
متن کاملThe Nudeotide Sequences of Two Trna Genes from Tobacco Chloroplasts
Recombinant plasmids which contain EcoRI fragments of tobacco chloroplast DNA carrying tRNA genes were constructed. Plasmids pTC211 and pTC293 contain the base sequences for tRNA in their 1.4 and 1.1 Md EcoRI fragments, respectively. These two tRNA sequences are identical and are; 5'-TCCTCAGTAGCT CAGTGGTAGAGCGGTCGGCTGTTAACCGATTGGTCGTAGGTTCGAATCCTACTTGGGGAG-3. Each tRNA gene is located at about ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
دوره 5 شماره
صفحات -
تاریخ انتشار 2015